Mention the essential features of basic education​

Answers 2

Explanation:

The main feature of basic education are— free and compulsory education for children of 7—14 years, education through craft, self supporting education, mother tongue as medium of instruction, ideal citizenship and flexible curriculum.

Answer:

The main feature of basic education are— free and compulsory education for children of 7—14 years, education through craft, self supporting education, mother tongue as medium of instruction, ideal citizenship and flexible curriculum.

If you know the answer add it here!

Can't find the answer?

Other related questions that may help you

his dream of holiding an exhibition______ into reality when he shifted to delhi

Answer:

His dream of holding an exhibition turned into reality when he shifted to delhi. is the right answer hope it helps.

In file menu place is used to

Answer:

often appears as the first item in the menu bar, and contains commands relating to the handling of files, such as open, save, print, etc

DNA coding strand: TAC ATG CGG ATT ACT GTA DNA template strand: ATG TAC GCC TAA TGA CAT mRNA: UAC AUG CGG AUU ACU GUA1. DNA coding strand:CCC TCA ATC GAG AAA GGT DNA template strand: mRNA:​
question img

Answer:

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’

A company wishes to make their order placing process more secure To do this they will provide the customer an OTP to ensure that the order is not being placed by a robot. The OTP is calculated as the reversal of the order amount.Write an algorithm to find the OTP, caltulated as the reversal of the order amount.​

Answer:

Showing results for A company wishes to make their order placing process more secure To do this they will provide the customer an OTP to ensure that the order is not being placed by a robot. The OTP is calculated as the reversal of the order amount. Write an algorithm to find the OTP, calculated as the reversal of the order amount.

Search instead for A company wishes to make their order placing process more secure To do this they will provide the customer an OTP to ensure that the order is not being placed by a robot. The OTP is calculated as the reversal of the order amount. Write an algorithm to find the OTP, caltulated as the reversal of the order amount.

Other English Questions

Log in with Google

 or

Forgot your password?

I don't have an account, and I want to Register

Choose a language and a region

English

United States

Polski

Polska

Português

Brasil

English

India

English

Philippines

Español

España

Bahasa Indonesia

Indonesia

Türkçe

Türkiye
How much to ban the user?
1 hour 1 day 100 years